Mature sequence bta-miR-2284w

• Accession number: MIMAT0017393
• ID: bta-miR-2284w
• Stem-Loop: bta-mir-2284w
• Sequence: aagaguuuguucggguuucuc
• Deep sequencing: 1034 reads, 64 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-2284w

References

1. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2. PMID:20423511 "Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development" Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL BMC Mol Biol. 11:29(2010).
3. PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).