Mature sequence bta-miR-2284w

Accession numberMIMAT0017393
IDbta-miR-2284w
Stem-Loop bta-mir-2284w
Sequence
aagaguuuguucggguuucuc
Get sequence
Deep sequencing1034 reads, 64 experiments
Predicted targets

References

1
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).
2
3
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).