Mature sequence rno-miR-434-5p

Accession numberMIMAT0017307
IDrno-miR-434-5p
Previous IDsrno-miR-434*
Stem-Loop rno-mir-434-1 rno-mir-434-2
Sequence
agcucgacucaugguuugaacca
Get sequence
Deep sequencing476028 reads, 426 experiments

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).