Mature sequence rno-miR-499-3p

• Accession number: MIMAT0017227
• ID: rno-miR-499-3p
• Previous IDs: rno-miR-499*
• Stem-Loop: rno-mir-499
• Sequence: aacaucacagcaagucugugcu
• Deep sequencing: 1650 reads, 210 experiments
• Predicted targets:
  • TargetScanVert:rno-miR-499-3p
  • miRDB:rno-miR-499-3p

References

1. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
2. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).