Mature sequence rno-miR-208a-5p

Accession numberMIMAT0017155
IDrno-miR-208a-5p
Previous IDsrno-miR-208*
Stem-Loop rno-mir-208a
Sequence
gagcuuuuggcccggguuauac
Get sequence
Deep sequencing3378 reads, 31 experiments
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).