Mature sequence rno-miR-34a-3p

• Accession number: MIMAT0017106
• ID: rno-miR-34a-3p
• Previous IDs: rno-miR-34a*
• Stem-Loop: rno-mir-34a
• Sequence: aaucagcaaguauacugcccua
• Deep sequencing: 660 reads, 182 experiments
• Predicted targets:
  • TargetScanVert:rno-miR-34a-3p
  • miRDB:rno-miR-34a-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).