Mature sequence mmu-miR-211-3p

Accession numberMIMAT0017059
IDmmu-miR-211-3p
Previous IDsmmu-miR-211*
Stem-Loop mmu-mir-211
Sequence
gcaaggacagcaaaggggggc
Get sequence
Deep sequencing250 reads, 23 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).