Accession | MIMAT0016990 |
Description | mmu-miR-149-3p mature miRNA |
Hairpins | |
Sequence | GAGGGAGGGACGGGGGCGGUGC |
Evidence |
experimental
Illumina [4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 | has_input UniProtKB:P42227 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29029439 | occurs_in UBERON:0002107 |
involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29029439 | occurs_in UBERON:0002107 |
involved_in | GO:1904893 negative regulation of receptor signaling pathway via STAT |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29029439 | occurs_in UBERON:0002107 |