Mature sequence hsa-miR-4326

Accession numberMIMAT0016888
IDhsa-miR-4326
Stem-Loop hsa-mir-4326
Sequence
uguuccucugucucccagac
Get sequence
Deep sequencing1362 reads, 128 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).