Accession | MIMAT0016847 |
Description | hsa-miR-378c mature miRNA |
Hairpins | |
Sequence | ACUGGACUUGGAGUCAGAAGAGUGG |
Evidence |
experimental
SOLiD [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|