Mature sequence hsa-miR-378c

Accession numberMIMAT0016847
IDhsa-miR-378c
Stem-Loop hsa-mir-378c
Sequence
acuggacuuggagucagaagagugg
Get sequence
Deep sequencing5884646 reads, 159 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).