Mature sequence lja-miR2111-5p

Accession numberMIMAT0016366
IDlja-miR2111-5p
Previous IDslja-miR2111
Stem-Loop lja-MIR2111
Sequence
uaaucugcauccugagguuua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19854858 "Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing" Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ Plant Physiol. 151:2120-2132(2009).