Mature sequence gso-miR2109

Accession numberMIMAT0016363
IDgso-miR2109
Stem-Loop gso-MIR2109
Sequence
ugcgagugucuucgccucuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).