Mature sequence gso-miR1510a

Accession numberMIMAT0016356
IDgso-miR1510a
Stem-Loop gso-MIR1510a
Sequence
uguuguuuuaccuauuccacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20021554 "Identification of microRNAs in wild soybean (Glycine soja)" Chen R, Hu Z, Zhang H J Integr Plant Biol. 51:1071-1079(2009).