Mature sequence ahy-miR156b-5p

Accession numberMIMAT0016318
IDahy-miR156b-5p
Stem-Loop ahy-MIR156b
Sequence
uugacagaagauagagagcac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).