Mature sequence ppy-miR-1285b

Accession numberMIMAT0016208
IDppy-miR-1285b
Stem-Loop ppy-mir-1285b
Sequence
ucugggcaacaaagugagaccu
Get sequence
Deep sequencing reads, experiments

References

1