Mature sequence ppy-miR-942

Accession numberMIMAT0016140
IDppy-miR-942
Stem-Loop ppy-mir-942
Sequence
ccuucucuguuuuggccauggg
Get sequence
Deep sequencing reads, experiments

References

1