Mature sequence ppy-miR-133b

Accession numberMIMAT0015756
IDppy-miR-133b
Stem-Loop ppy-mir-133b
Sequence
uuugguccccuucaaccagcua
Get sequence
Deep sequencing reads, experiments

References

1