Mature sequence nvi-miR-932

Accession numberMIMAT0015702
IDnvi-miR-932
Stem-Loop nvi-mir-932
Sequence
ucaauuccguagugcauugcag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).