Mature sequence nvi-miR-100

Accession numberMIMAT0015677
IDnvi-miR-100
Stem-Loop nvi-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).