Mature sequence zma-miR169o-3p

Accession numberMIMAT0015326
IDzma-miR169o-3p
Previous IDszma-miR169o*
Stem-Loop zma-MIR169o
Sequence
ggcaggucuucuuggcuagc
Get sequence
Deep sequencing6 reads, 3 experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).