Mature sequence zma-miR167j-3p

Accession numberMIMAT0015322
IDzma-miR167j-3p
Previous IDszma-miR167j*
Stem-Loop zma-MIR167j
Sequence
gaucauguggcaguuucauu
Get sequence
Deep sequencing161 reads, 107 experiments
Database links
QuickGO function

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).