Mature sequence cel-miR-788-3p

Accession numberMIMAT0015240
IDcel-miR-788-3p
Previous IDscel-miR-788*
Stem-Loop cel-mir-788
Sequence
ggaaauggauuagaaucguggaaa
Get sequence
Deep sequencing11664 reads, 16 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4