Mature sequence zma-miR168a-3p

• Accession number: MIMAT0015191
• ID: zma-miR168a-3p
• Previous IDs: zma-miR168a*
• Stem-Loop: zma-MIR168a
• Sequence: cccgccuugcaccaagugaa
• Deep sequencing: 1746 reads, 145 experiments
• Database links:
  • RNAcentral:URS0000759EDD_4577

References

1. "Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2. PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3. PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).