Mature sequence zma-miR156b-3p

• Accession number: MIMAT0015127
• ID: zma-miR156b-3p
• Previous IDs: zma-miR156b*
• Stem-Loop: zma-MIR156b
• Sequence: gcucacccucuaucugucagu
• Deep sequencing: 100 reads, 33 experiments

References

1. "Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2. PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3. PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).