Mature sequence cel-miR-360-5p

Accession numberMIMAT0015121
IDcel-miR-360-5p
Previous IDscel-miR-360*
Stem-Loop cel-mir-360
Sequence
uugugaccguuguuacgguca
Get sequence
Deep sequencing95 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).