Mature sequence hsa-miR-3190-5p

Accession numberMIMAT0015073
IDhsa-miR-3190-5p
Previous IDshsa-miR-3190-5p;hsa-miR-3190
Stem-Loop hsa-mir-3190
Sequence
ucuggccagcuacgucccca
Get sequence
Deep sequencing16 reads, 11 experiments
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).