Mature sequence hsa-miR-3170

Accession numberMIMAT0015045
IDhsa-miR-3170
Stem-Loop hsa-mir-3170
Sequence
cugggguucugagacagacagu
Get sequence
Deep sequencing86 reads, 31 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).