Mature sequence hsa-miR-3127-5p

Accession numberMIMAT0014990
IDhsa-miR-3127-5p
Previous IDshsa-miR-3127
Stem-Loop hsa-mir-3127
Sequence
aucagggcuuguggaaugggaag
Get sequence
Deep sequencing1220 reads, 81 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).