Mature sequence hsa-miR-548s

Accession numberMIMAT0014987
IDhsa-miR-548s
Stem-Loop hsa-mir-548s
Sequence
auggccaaaacugcaguuauuuu
Get sequence
Deep sequencing2727 reads, 121 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).