Mature sequence api-miR-3036

Accession numberMIMAT0014773
IDapi-miR-3036
Stem-Loop api-mir-3036-1 api-mir-3036-2 api-mir-3036-3 api-mir-3036-4 api-mir-3036-5
Sequence
auugguuucuagaucucagca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).