Mature sequence api-miR-252b

Accession numberMIMAT0014772
IDapi-miR-252b
Stem-Loop api-mir-252b
Sequence
cuaaguaguagcgccaacgguga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).