Mature sequence api-miR-3032

Accession numberMIMAT0014768
IDapi-miR-3032
Stem-Loop api-mir-3032
Sequence
uguuaguauaacucuuaguaaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).