Mature sequence api-miR-3015a

Accession numberMIMAT0014750
IDapi-miR-3015a
Stem-Loop api-mir-3015a-1 api-mir-3015a-2
Sequence
uuacuggacauuguaagaacgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).