Mature sequence api-miR-996

Accession numberMIMAT0014746
IDapi-miR-996
Stem-Loop api-mir-996-2 api-mir-996
Sequence
gugacuagaguuacacucguc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).