Mature sequence api-miR-971

Accession numberMIMAT0014745
IDapi-miR-971
Stem-Loop api-mir-971-2 api-mir-971
Sequence
uuugguguucaaccuuacaguga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).