Mature sequence api-miR-92b

Accession numberMIMAT0014743
IDapi-miR-92b
Stem-Loop api-mir-92b-1 api-mir-92b-2
Sequence
uauugcacuugacccagccugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).