Mature sequence api-miR-92a

Accession numberMIMAT0014742
IDapi-miR-92a
Stem-Loop api-mir-92a-1 api-mir-92a-2
Sequence
uauugcacaugucccggccaau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).