Mature sequence api-miR-315

Accession numberMIMAT0014730
IDapi-miR-315
Stem-Loop api-mir-315
Sequence
uuuugauuguugcucagaaagcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).