Mature sequence bmo-miR-3001

Accession numberMIMAT0014665
IDbmo-miR-3001
Stem-Loop bmo-mir-3001
Sequence
uaaguugaaagaauuguagauuuuga
Get sequence
Deep sequencing99 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20089182 "Deep sequencing of small RNA libraries reveals dynamic regulation of conserved and novel microRNAs and microRNA-stars during silkworm development" Jagadeeswaran G, Zheng Y, Sumathipala N, Jiang H, Arrese EL, Soulages JL, Zhang W, Sunkar R BMC Genomics. 11:52(2010).