Mature sequence api-miR-iab-4

Accession numberMIMAT0014129
IDapi-miR-iab-4
Stem-Loop api-mir-iab-4
Sequence
acguauacuaaauguauccuga
Get sequence
Deep sequencing reads, experiments

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).