Mature sequence bma-miR-100a

Accession numberMIMAT0014112
IDbma-miR-100a
Stem-Loop bma-mir-100a
Sequence
aacccguaguuucgaacaugug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19874857 "Cloning and bioinformatic identification of small RNAs in the filarial nematode, Brugia malayi" Poole CB, Davis PJ, Jin J, McReynolds LA Mol Biochem Parasitol. 169:87-94(2010).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).