Mature sequence sbi-miR169p

Accession numberMIMAT0014043
IDsbi-miR169p
Stem-Loop sbi-MIR169p
Sequence
uagccaagaauggcuugccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).