Mature sequence ssc-miR-1285

Accession numberMIMAT0013954
IDssc-miR-1285
Stem-Loop ssc-mir-1285
Sequence
cugggcaacauagcgagaccccgu
Get sequence
Deep sequencing1221 reads, 14 experiments

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).