Mature sequence ssc-miR-133b

Accession numberMIMAT0013869
IDssc-miR-133b
Stem-Loop ssc-mir-133b
Sequence
uuugguccccuucaaccagcuau
Get sequence
Deep sequencing1229 reads, 11 experiments

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).