Mature sequence bta-miR-669

Accession numberMIMAT0013838
IDbta-miR-669
Stem-Loop bta-mir-669
Sequence
ugugggugugugcaugugcgug
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).