Mature sequence bmo-miR-2807a

Accession numberMIMAT0013716
IDbmo-miR-2807a
Stem-Loop bmo-mir-2807a-1 bmo-mir-2807a-5 bmo-mir-2807a-2 bmo-mir-2807a-6 bmo-mir-2807a-3 bmo-mir-2807a-4
Sequence
uuccagcugcauacaaauuuca
Get sequence
Deep sequencing126 reads, 2 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).