Mature sequence bmo-miR-2792-3p

Accession numberMIMAT0013691
IDbmo-miR-2792-3p
Stem-Loop bmo-mir-2792
Sequence
uagauuagauagcgauuccauu
Get sequence
Deep sequencing32 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).