Mature sequence bmo-miR-2792-5p

Accession numberMIMAT0013690
IDbmo-miR-2792-5p
Stem-Loop bmo-mir-2792
Sequence
ugguaucguucuuuaaucaaca
Get sequence
Deep sequencing10 reads, 1 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).