Mature sequence bmo-miR-2778a-3p

Accession numberMIMAT0013665
IDbmo-miR-2778a-3p
Previous IDsbmo-miR-2778a
Stem-Loop bmo-mir-2778a-1 bmo-mir-2778a-3 bmo-mir-2778a-2 bmo-mir-2778a-4
Sequence
cagaguacgcaaaaaaacaauu
Get sequence
Deep sequencing98079 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).