Mature sequence bmo-miR-2778a-5p

Accession numberMIMAT0013664
IDbmo-miR-2778a-5p
Previous IDsbmo-miR-2778a*
Stem-Loop bmo-mir-2778a-1 bmo-mir-2778a-3
Sequence
guuuuuuugcauauccugca
Get sequence
Deep sequencing3118 reads, 3 experiments

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).