Mature sequence bmo-miR-2774a

Accession numberMIMAT0013658
IDbmo-miR-2774a
Stem-Loop bmo-mir-2774a-1 bmo-mir-2774a-3 bmo-mir-2774a-4 bmo-mir-2774a-2
Sequence
cucgguggaagaucgucccu
Get sequence
Deep sequencing3097 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).